Download Now! CCTCGAGAATTTAACAAA

From Uncyclopedia, the content-free encyclopedia

Jump to: navigation, search

To return to the main article click the Back back button on your browser. CTCTAGTTGTCCGGATCTTGATCCTACTTGTCTTAGTTGTCTGGTGGATTGTAAGCAGTATACTTGGCATCCTCTGTAGCGG TTGGATTGGCGGTTGTAGCGGTGTTGTCTGGTGGATTGGCCGCAGCGGTGTTGGCCTGATCTTCTTAGTACTTGTAGTACTT GTTATAGTGATCCTTGGCCTCCTAGTGGTCGGGATCCTTTAACATG


edit Status

download will begin shortly:

TATGTTTGAGGGGTATACTTGGTATCGTTGGCAGTTTCCGGAGCAGCTTTATTGGTATACTCGTCTGCAGTTGTTGGAGCTT TGTGGGGTTTATTGTCTGGTGGATTGGGTGGAGTTGTTTTGTGGGGTGGATCCGGATTGTTATAGTGATTGTCTTCCTTAGT ATACGGGTTGTCTTAGTTGGCTTAGTGGTACGTTTAGGCAGCTTTGGTATCTTTGTTATAGTGATTGGTAGCTGTATAGTCT


Loading:

Loading bar blue


If download fails to start, it is because we have the same amount of download volumes but can't be bothered to do anything about it. Please feel free to try the looking glass site, http://www.attotron.com/cybertory/analysis/secret.htm

edit Download details

  • File size: 200mb
  • Licence: free to try, £52,34/$86.83 to buy.
  • Downloads: 42,253
  • Publisher: Adobe
  • Editors rating: ***** great!

This download is a DNA decoder plug-in for your selected web browser. This software is provided by Adobe and distributed by UDL. Making this software run without that pointless register box will cost a ridiculous amount of money. This plug-in will self destruct in 30 days. The download is powered by a criminally insane mental patient's excel-later drivers so probably wont work. A Longband modem is required; trying to download on dial-up will cause great anger and a new computer screen. (bricked)

system requirements


  • Hard drive space: 1.2Gb
  • Drives: DVD burner
  • processor: 62bit
  • RAM: 512mb
  • Graphics Driver: GeForce 9900 or better
  • sound Driver: P6VECSE or better

Other details: Three credit card numbers for our prize draw, for details please see Free Trial

edit Terms of Use

users must comply with the terms of use below:

TGGGGTTAGTTGTCCGGAGCAGCTTCGTTGTCTGGTGTATCGTTGTCCTGAGCCGCCGTATCGGGTTTTAAGATT

  1. All use must comply with the G.D.P. and G.W.B. as set out by the T.I.T. soon to become the P.M.P.D.G.
  2. You may not reinstall this software.
  3. By downloading this plug-in the distributor, coder, nueclear power, Mc donalds, google, sponsers, the monarchy, ebay or Hull can be held responsible for computer failure, virus infection, meltdown, uranium enrichment, weight gain, porn found on search engines, heart failure, spending money, boredom, Civil war, meteor apocalypse, alien invasion, decapitation disease, being ripped off or having a bad holiday.
  4. This download is intended for external use only, Not to be taken rectally.
  5. Apply this download sparingly twice a day to the affected area for two weeks.
  6. Do not stop using this download unless advised by your doctor.
  7. Should you have an allergic reaction to this download stop using immediately and seek medical help.
  8. Should this download come into contact with skin or eyes rinse the area and seek medical attention.
  9. Always read the label.
  10. This download is not the elixir of life.
  11. This download may be subject to the placebo effect.
  12. Do not Microwave this Download.
  13. Store this download in a cool dry cupboard
  14. This Download is best served cold.
  15. No purchase necessary, prices without tax, however Canadian coins are not accepted.
  16. Downloads are not tax deductible.
    Installing
  17. One download fits all.
  18. Colours on download may fade if left in light.
  19. Hand wash only
  20. When using this download, do so in a well lit room, and do not sit too close to the Screen.
  21. Smoking makes you look 'ard.
  22. This is not a toy.
  23. White and dark downloads cannot be washed together.
  24. Drinking while using this download is a criminal offence.
  25. You cannot do anything with this software, you cannot use this software, you cannot share this software with anyone, edit it, redistribute it or talk about it to anyone.
  26. Uncyclopieda Dist. Lmt. (UDL) disclaims any and all responsibility or liability for the accuracy, content, completeness, legality, reliability, or operability or availability of information or material displayed in the UDL Service results. UDL disclaims any responsibility for the deletion, failure to store, misdelivery, or untimely delivery of any information or material.
  27. UDL disclaims any responsibility for any harm resulting from downloading or accessing any information or material on the Internet through the UDL Service.
  28. UDL reserves the right to modify, change, adjust, vary, alter, amend, exchange, swap, replace, substitute, trade, transform, convert, switch, regulate, fiddle with, correct, bend, tweak, revise, rework, tinker, maintain, fine tune, tune, polish up, perfect, work on, improve, refine, hone, tighten up, round off, sharpen, enhance, make better, upgrade, raise or advance these terms and conditions under new circumstances, or not, as the UDL sees fit to do so, or not, or to be awkward.
  29. The UDL service is provided "as is", with no warranties whatsoever. If this download becomes corrupted it it your own fault, idiot, cruise the internet looking for other losers like yourself. UDL expressly disclaims to the fullest extent permitted by law all express, implied, and statutory warranties, including, without limitation, the warranties of merchantability, fitness for a particular purpose, and non-infringement of proprietary rights. UDL disclaims any warranties regarding the security, reliability, timeliness, and performance of the UDL service. UDL disclaims any warranties for any information or advice obtained through the UDL service. UDL disclaims any warranties for services or goods received through or advertised on the UDL service or received through any links provided by the UDL service, as well as for any information or advice received through any links provided in the UDL service.
  30. All licences, including software, driving and alcohol, are property of UDL or their respected owners or not as the case may be.
  31. The UDL reserves the right to do anything.
  32. It is physically impossible to comply with the terms of use.
  33. Failure to comply with the terms of use is a fineable (up to £2000/$4000) offence.

edit Installation procedures

Adobe1
Adobe2
Adobe3
Adobe4
Adobe5
Adobe6
  1. Download plug-in.
  2. Save Plug-in to Desk-Top.
  3. Before running Installer close all other programs, your flying solo now, no help from the net.
  4. Double click the icon on the Desk-Top.

The computer will now do one of two things:

  • you sit there and watch your computer lock up.
  • The installer will open successfully.

If the installer ever opens then:

  1. Click the next Button.
  2. Click the next Button.
  3. Select the licence agreement toggle, you don't agree but click it anyway.
  4. Click the next Button.
  5. Click the next Button.
  6. Click the next Button.
  7. Click the Finish Button.

The program will now be installed onto your computer. Installation of the Plug-in will take several Hours. DO NOT disturb your computer during this process, your computer is in a vegetative state, like a teenager or a sleeping baby. DO NOT click cancel, the computer will either lock up or try to uninstall the program which will take just as long.

congratulations you have successfully installed this plug-in, you are now ready for a new computer.

CTATCTTAGTATTTGTCCGGAGCAGCTGTATACGGGTTGGGCTAGTAGGTT


GAAGGTTTATTGTCTGGTGGATTGGGTGGAGTTGTTTTGGCATCCGGATTGT TATAGTGATTGTCGTCTGTAGTTGTTTTGGCTTAGTGGTACTTGGGTGGATC CGGATTGGCTGTATACGGGGCCGCATCTTTTAACATGTTGGAAGGATTGGGA TCGTCTGCAGCCGTTGTATCGGGTGGAGCTTTGTCTGGTGCATCTTTGTTAT AGTGATTGGGTGCAGCTTTGGCATTGTGGTAGTCCGTGGTATACGGGTTGTG CGGATCCTCGGTATAGTACTTGTAGGGCTTGTCTGGTGGATTGTATGTTTGA GGGTTTAACATCGTATACTTGTAGTGCGGATCCTTGAATAGCTTGGTTGTAT ACGGATCGTTGTGATATTTTAACATATTGGCTTGATAATAATTATTTAACAT GTTGCTATCTTAGTATTTGTCCGGAGCAGCTGTATACGGGTTGGGCTAGTAG GTTTTTAACAAATTGCAGTTGTCCGGAGCAGTTGTTTTATTGTAAGGAGCAT ACTTGGTATCTTTGTTATAGTGATCCTTGTAAGCAGTGGTATACGGGTTGTA AGGATTGTAAGCAGCTTTTAACATGTTGCACTAGTGGTTGATCTGATAAGCC TTGGCGGCATACTTGTTATAGTGATTGGCCGGATTTAACATATTGGTATAAT ACTAGTCTTTGGGGTAGGTATACGGGTTGTCTTAGTTGTCGGCATTATTGGC ATACTTATCTGGTGTATACGGGTTGTATTCCTAGGGCTAGTGATACGCTTTG GTATACTTGTCTGGTGTATCGTTGGCCGTATCTTTTAACATATTGGCATAAT TGGTATTTAACATGTTGATCTGATAAGCCTTGGCATCGTCGTTGTCGTCTTA GTATTTGTCCGGAGCAGCTGTATACGGGTCTGGTGTATCGTTGGGCTCCGGA GCAGTGGTATACTTGGCGTCCGCATATTTTAACATGTTGAGTTAGTCCGGAG CTTTGTTAGGATCTTTTAAGATTTTGGTATCTTCGTTGGCATTGGCCGTTTA GTAGGCTTTATTGTAAGTATCCGTAGCGGTTGGATTGTTATAGTGATTGGGG TAGTCTTTGGTATCTTTGTCTTAGTTGTGGTAGTCCGTGTTTAACATGTTGG AGTAGTGATTGGTGTACTAGTGGTTGTCTGGTGCATCTTTGGGCGGAGGAGT TGTATACGGGTTGTTATAGTGATTGGGGGGATCTTTGTGGGGTGGATCCGGA TTGTTATAGTGATTGTGGGCATACTCTTTGTCTTAGTTGTCGTCTGCAGCCT TGGGATGCGGATCCTTATAGTACGGATTGGTATACTTGTCTGGTGGATTGGG CGCAGCGGGATTTAAGATTTTGGAGTAGTGATTGTCGGGTTAGTGAGTTGCT TTGTTGGGTGCATGCGGATTGTCGTCTTAGTATTATGGAGCTTTGTCCGGAG CAGCTGTATACGGGTTGGCAGGGGGATCGTTGGCCGCAGCGGTGTTTAACAT ATTGTTATAGTGATCCTTGTCCGGAGCAGTTGTTTTATTGGGGTAGGTATAC GGGTTGTCTTAGTTGGGGGGATCTTTGGTATCTTTGTACTAGTGGTTTAACA TATTGGTATAATTGGGGTAGTACTACGCATTGGGGGGATCTTTGTTATAGTG ATTGTCGTAGTTGGGTGCATCCGCTTTGGCATACGCTTTGTCGTAGTTTAAC ATATTGTAGGGTTTTAACATATTATAGTGATGCGGATTGGGGTAGTACGGAT TTAACATGTTGATCGCATAATAAGTATCTTTTAACATGTTGCAGTTGTCGTG ATATTATTAGTCGGGATTGTCTGGTGTATCGTTGGTATCGTTGGCATTGGGG TAGTAGGCTTTGTCTGTATAAGGATTGTCTTAGTTGTCGGCATTATTGTCTG GTGCATCTTTGTGGGGATTGGCATCCGGATTGTAGTGATCTTTGTAGGGCTT GTAAGCATCCTAAGTATCTGGATTTAACATGTTGTTGAGTTAGTCCGGAGCT TTTAACATATTGGCCTAGTCCGGAGCTTTTAACATATTGGCCTAGTCCGGAG CTTTTAACATATTGAGTCGACGTATGATCTTTAACAAATTGTGGGGTGCATC TTTGTCTGGTGGATTGGGTGGAGTTGTTTTGTTATAGTGATTGTCGTCTGTA GTTGTTTTGTCCGGAGCAGCTGTATACGGGTTGGGCTAGTCCTTGGGCTAGT AGGTTTTTAACATGTTGCAGTTTAACACGTGCTTGGGGTAGTCTTTGTACTA GTCTGGTGTATACGGGTTGGTATACTCTGGATCCGGATCGTCTGTATACGGG TTGTCTTAGTTGTCGGCATTATTGTCTTAGTTGTTATAGTGATTTAACATGT TGCAATAGTTGAGGTGGGCATTATTTAACAAATTGGAGTAGTGATCCTTGGC ATTGTATGGATCGGTGTTATTGGTTGTATCTTCTGTTGGATTGGGGTGATTA TTGGCATCCTACTTTAACACGTCTTTGTTATAGTGATTTAACATGTTGGAAG GAGTTGTTTTGTTATAGTGATTGGTGTACTAGTGGTTGTCTGGTGGATCCGG ATCGTTGTACTAGTCTGGTGTATACGGGTTGGTATTGGCGGCATACTTGGCT TAGTTGGCAGCCTAGTGATCTTTGTCTGGTGCATCTTTGTCCGTAGGGGGTT CTTTTAAGATTTTGGAACGTCGACCTCAATTTAACAAATTGCAGTTGTGGGT AGTTGTTTTGTCGTAAGTATCTGGATTGTTATAGTGATTGGCTTAGTGGTAC TTGTGGGGTGGATACTTGTTATAGTGATTGGTTGGATCGTCTTTGTCGTGAT CGTATGGAGCGTCTTTGGTATCTTTTAACATGTTGCACAGGCACTTTAACAA ATTTAACATGTTTAACATGTTTAACATGTTTAACATGTTTAACATGTTTAAC ATGTTTAACATGTTTAACATGTTTAACATGTTTAACATGTTTAACATGTTTA ACATGTTTAACATGTTTAACATGTTTAACATGTTTAACATGTTTAACATGTT TAACATGTTTAACATGTTTAACATGTTTAACATGTTTAACATGTTTAACATG TTTAACATGTTTAACATGTTTAACATGTTTAACATGTTTAACATGTTTAACA TGTTTAACATGTTTAACATGTTTAACATGTTTAACATGTTTAACATGTTTAA CATGTTTAACATGTTTAACATGTTTAACATGTTTAACATGTTTAACATGTTT AACATGTTTAACATGTTTAACATGTTTAACATGTTTAACATGTTTAACATGT TTAACATGTTTAACATGTTTAACATGTTTAACATGTTTAACATGTTTAACAT GTTTAACATGTTTAACATGTTTAACATGTTTAACATGTTTAACATGTTTAAC ATGTTTAACATGTTTAACATGTTTAACATGTTTAACATGTTTAACATGTTTA ACATGTTTAACATGTTTAACATGTTTAACATGTTTAACATGTTTAACATGTT TAACATGTTTAACATGTTTAACATGTTTAACATGTTTAACATGTTTAACATG TTTAACATGTTTAACATGTTTAACATGTTTAACATGTTTAACATGTTTAACA TGTTTAACATGTTTAACATGTTTAACATGTTTAACATGTTTAACATGTTTAA CATGGGGTAGTACGGATTGTTGTTAGGATCTTTTAAGATTTTGCCTTAGTTT AACATGTTGGAAGGTTTATTGTGGTAGTACTTTAACACGTCTTTGTTATAGT GATTGGTCTGATCGTCTTTGGTTGGAGCATGCGGATTGTAAGGATTGGCAGT TTAGTACGGATTTAACATATTGTATGTTGGAGCATCGGGATTTAACATGTTG CTATAGTTGGTATCTTCGTTGGCGTAGTAATATGCATACTTATTGTTATAGT GATTGTGGGCATACTCTTTGTCTGGTGGATACTTGGTATCGTTGGTATCTTT TAAGATTTTGGAGTAGTGATTGTAATGATCGTCTTTGGCCGGATTGTCGGGA TCCGTATAGTGATCGGTTTTATTGGCCTAGTCCGGAGCTTTGTCTTAGTTGT GGGCATACTCTTTGTCTTAGTTGTCCGGAGCAGCTTTGGCAGTTGTTTTGTC TGGTGTATCGTTGGGGTAGGCCTCGGGTGTATCTGGATTTAACATGTTGCAG TTGGTGTACTAGTGGTTGGTATTGTGGGTAGTTGTTTTGGTTGTATGCGGAT ACTTGTGATATTTGTTATAGTGATCCTTGGCTGCATTATTGGGCTAGTCCTT GAGTCGACCCCCCCGAATACCACTATTGTTATAGTGATTTAACATGTTGCTA GGAGGATTGTGGTAGTCCGTGGGAGCTTTGGCTGTAGCTTACTCTTTGGTAT CTTTTAACATGTTGCCTTAGTTTAAGATTTTGGAAGGAGTTGTTTTGGTATA ATTGGGTGCATCCGCTTTGTATTGATCGGGTGGAGCTTTGTCTTAGTTGTCT GGTGTATACGTGTTGTAGGGCTTGTCGTCTTGAGGCGGCTTGTCTTAGTTGT CGGCATTATTGTAGTACTTGTCTGGTGTATCGTTGTATGCAGGGGGATTTAA CATGTTGAGGGGTTTGTCTGGTGGATTGGCCTAGTCTTCTGGATAATTGTAG GGCTTGTCTGGTGGATTGTATGCAGGGGGATTTAACATATTGGTATTGTCGG CAGTAGCTTTGTACTAGTCTGGTGTATACGGGTTGGGGTAGTAGGCTTTGGC ATCTTTGGCAGTTGTTTTTAACATGTTGTGGGCATCGTCTGGATTGTAGGGC TTGTCTGTATAAGGATTTAACATGTTGGAAGGTTAGTTGGTATCGTTGGCAG CGTCTTGAGCAGTTGTTTTATTGGGGTAGGTATACGGGTTGTCTTAGTTGTC CGGAGCAGCTTTGGCAGTTTTGTCTGGTGCATCTTTTAACATG

Personal tools
projects