DNA

From Uncyclopedia, the content-free encyclopedia

(Redirected from Dna)
Jump to: navigation, search
The human DNA is composed of anal beads strung along and twisted together until it looks pretty.

DNA, not to be confused with Disney Nigger Assholes, stands for Destructive Nuclear Keanu Apples I raise the question "What is it that makes us different from one another?" If you replied with God, you would be right! Also, the question I asked was rhetorical, so you just made yourself look silly by answering it. The answer is inside our cells... and no, I don't mean prison cells. Going back to our cells, let's say you take a tiny yellow submarine and head into one of our cells. You then go into the nucleus and you find a little thing called DNA, or as he likes to be called Cytosine Guanine Adenine Adenine Cytosine Thymine Thymine Guanine Guanine Cytosine Guanine Guanine Thymine Adenine Cytosine Cytosine Guanine Guanine Guanine Thymine Thymine Adenine Thymine Thymine Thymine ... Also, the only good thing to come out of DNA was Deoxys. randomum ad infinitum.

Contents

edit What does DNA stand for?

Bouncywikilogo9.gif
For those without comedic tastes, the so-called experts at Wikipedia think they have an article very remotely related to DNA.

DNA stands for the National Dyslexic Association, and also Do Not Abbreviate. DNA is an anagram of the word "and" and the name "dan". DNA also stands for orphaned dolphins around the world and YOU can make a difference by giving a shit. Did you know that DNA donated $5 to the Charity for Nutless Newts yesterday? No? Neither did we. But my mom told me today. Speaking of which, my mom and I share 87% of our DNA. The rest is from our next door neighbor's gardener. Don't tell my dad. He's too busy having a midlife crisis.

edit How was DNA created?

DNA was forged many many years ago in the primordial soup when conditions on Earth were near hellish and were unable to support any forms of sentient life - in Utah, in other words. Mother Nature was working at her computer and did not have the graphic capabilities necessary to create a little critter. Seeing this, she created a programming language that could create a little critter for her. She gave this programming language the file extension .dna. Time passed and before you know it, DNA created all the life that we now see on this planet, and with the ability to repair itself, it does not need to be updated, which is the main reason why programmers love it and cuddle it and take it to bed with them.

However, this interpretation is challenged by my mommy. She said you should drink your milk so you can become strong and handsome like my next door neighbor's gardener. Speaking of which, he has nice muscles. I think I'm gay. That means I must vote republican so I can make the gay go away.

edit What is DNA made of?

DNA is composed of four nucleotides: Adenine=A, Thymine=T, Cytosine=C, and Guanine=G. Adenine bonds with Thymine and Cytosine bonds with Guanine. Combine these nucleotides into different orders and you can initiate a command for fuckin' strand of dna. For example, the 32-bit command

ATCGATGCATGACTAGCATCAGCAGTCGACTACGATCAGCATCAGCATCAGCATCGACTACGATCACGATCAGC

would print a weird strand of dna. Combine more in the same way and you're bound to make it perform other functions. There is even a rumor that if you type in the right DNA sequence and then convert those results into hexadecimal color code, then it will generate a long chromosome! So far, this has been accomplished. However, a mismatch between these nucleotides, such as that between C and too much A, can be particularly disastrous, resulting in a disfunctional C, especially in the presence of a ready and willing G.

When you speak it really fast, you will get a headache. This is not related to this article, but true nonetheless. My mom said so.

edit Fun Fact

Humans have roughly 6 billion base pairs of dna. Wow! That's a whoppin' amount of dna!

edit Can DNA be damaged?

Of course. When DNA is damaged, it's called a mutation. DNA mutation in real life is just like what you can find in X-Men, only instead of getting eye beams from a mutation, you get eye cancer. DNA mutations can result from any causes, such as living next to Chernobyl, laying out in the sun, talking on the cell phone, getting a nipple twister and getting struck on the noggin with depleted uranium.

edit So does DNA mutation explain why I have a wart on the foot growing out of my forehead?

NO, that is mostly because you sinned in a previous life, and God (which is an anagram of "dog") is punishing you with a disgusting warty foot growing out of your forehead, you bastard.

edit Not To Be Confused With

Pencil2.jpg
Look up DNA in Undictionary, the twisted dictionary

edit See also

Personal tools
projects