DNA
From Uncyclopedia, the content-free encyclopedia.
DNA stands for Destructive Nuclear Keanu Apples. I raise the question "What is it that makes us different from one another?" If you replied with God, you would be right! Also, the question I asked was rhetorical, so you just made yourself look silly by answering it. The answer is inside our cells... and no, I don't mean prison cells. Going back to our cells, let's say you take a tiny yellow submarine and head into one of our cells. You then go into the nucleus and you find a little thing called DNA, or as he likes to be called Thymine Adenine Adenine Guanine Guanine Thymine Adenine Guanine Thymine Cytosine Thymine Guanine Thymine Cytosine Adenine Adenine Cytosine Guanine Thymine Cytosine Adenine Adenine Guanine Guanine Guanine ... Also, the only good thing to come out of DNA was Deoxys. randomum ad infinitum.
Contents |
[edit] What does DNA stand for?
DNA stands for DeoxyribonNucleic Acid. Don't listen to the retards that say deoxyribonucleic acid! Remembering what DNA stands for is as easy as A B C, which is as easy as 1 2 3. *The narrator breaks out into song* D N A. It's as easy as A B C. Which is as easy as 1 2 3— *The narrator receives a note and reads it* Hmm, my producer has stated that I am permanently barred from singing in the rest of this article. Fine by me. Besides, my job is to teach you, not to entertain you through silly little songs. It also stands for National Dyslexic Association. DNA may also stand for: Do Not Ask, or Dirty Noble Assholes, Dogs Need Anus, Dorky Nerd's Crack, or Dirty Nigerian Apple.
Scientists have recently discovered that human DNA is 99.47% similar to that of ketchup.
[edit] How was DNA created?
DNA was forged many many years ago in the primordial soup when conditions on Earth were near hellish and were unable to support any forms of sentient life - in Utah, in other words. Mother Nature was working at her computer and did not have the graphic capabilities necessary to create a little critter. Seeing this, she created a programming language that could create a little critter for her. She gave this programming language the file extension .dna. Time passed and before you know it, DNA created all the life that we now see on this planet, and with the ability to repair itself, it does not need to be updated, which is the main reason why programmers love it and cuddle it and take it to bed with them.
[edit] What is DNA made of?
DNA is composed of four nucleotides: Alcohol=A, Time=T, Cock=C, and Girls=G. Alcohol bonds with Time and Cock bonds with Girls. Combine these nucleotides into different orders and you can initiate a command for fuckin'. For example, the 32-bit command
ATCGATGCATGACTAGCATCAGCAGTCGACTACGATCAGCATCAGCATCAGCATCGACTACGATCACGATCAGC
would print "Hello World!" Combine more in the same way and you're bound to make it perform other functions. There is even a rumor that if you type in the right DNA sequence and then convert those results into hexadecimal color code, then it will generate a nude picture of Jessica Alba. So far, this has never been accomplished. However, a mismatch between these nucleotides, such as that between C and too much A, can be particularly disastrous, resulting in a dysfunctional C, especially in the presence of a ready and willing G.
[edit] Can DNA be damaged?
Of course. When DNA is damaged, it's called a mutation. DNA mutation in real life is just like what you can find in X-Men, only instead of getting eye beams from a mutation, you get eye cancer. DNA mutations can result from any causes, such as living next to Chernobyl, laying out in the sun, talking on the cell phone, getting a nipple twister and getting struck on the noggin with depleted uranium.
[edit] So does DNA mutation explain why I have a wart on the foot growing out of my forehead?
...Yes, yes it does. I think you might want to get that checked out; it looks infected.



