APL
From Uncyclopedia, the content-free encyclopedia
APL is an acronym standing for "A Pirate's Language", the most common extant dialect of pirate lingo in modern times. It is not to be confused with a language of a similar name, which was devised by hopeless virgins who spend their free time arguing over the subtle nuances of ring algebra.
Contents |
edit Language
APL was originally developed as a way to allow pirates to communicate their innermost thoughts with each other. Consider the following except from a poem written in the 1900s about male companionship:
Arr! Swab the deck, ye damned cur, lest I fire me cannon into ye cornhole. Ye scurvy dog, I'll throw ye to the fishes if ye cross me again! Methinks I'll dig fer buried treasure in me first mate.
edit Origins
APL is believed to have its origins in the genetic code. It is read from the 5' UTR to the 3' UTR, using the RNA Polymerase. When the RNA Polymerase has finished its job, (or gone on strike) magical faeries with rapiers make me feel good inside and lend me credence to start rambling about the apocalypse. The evolutionary function of these faeries is believed to have originated as an enzyme to aid in the Haber process. The same poem, written in old APL, would be transliterated as such:
5'ACCTAGGCTTAAAGGTCGTTA3'
It is unknown why modern APL has diverged so much from its ancestors. Recent archaeological evidence suggests that the pirates' ribosomes, in conjunction with the MPAA, successfully filed a lawsuit against the pirates on the basis of copyright infringement. The descendants of the pirates have filed an appeal with the United States Supreme Court regarding this issue, but to date, no progress has been made. A political interest group, the Pirate Party, was formed specifically to fight this decision.
Middle APL consists of a rudimentary grammar and lexicon. This form of APL marks the beginning of the transitory period from from old APL to modern APL, and has much in common with lolspeak. The above poem is rendered thusly in middle APL:
| ||
edit Keyboard
Since the invention of the typewriter, APL has been noted for requiring a special keyboard. This keyboard consists of only 5 keys, which include "wench", "scurvy", "arr!", and "bacon." An additional modifier key exists. ("grog") The "grog" key is typically useful for damn near everything, including knocking up the broads an aspiring pirate may happen upon, forcing said broad to bear child, and promptly leaving her on claim of "Special Pirate Responsibilities." Without the use of the "grog" key, the broad may not be guaranteed to declare immaculate conception when the child is born.
Integration of this keyboard layout into modern technology has been limited. This is mostly because pirates are too brazen to use technology of any sort: they are pirates, after all. Adoption has been slow due to the fact that pirates are stateless. However, ISO has recently assigned a committee tasked with standardizing a codepage for APL, and there has been some work to integrate the APL character set into Unicode.
edit Worldwide Usage
Census data indicates that there are several tens of individuals who speak modern APL, and perhaps one or two more that have learned it as a secondary language. There has been increasing concern over the dwindling numbers of APL speakers. Special interest groups such as the International House of Pancakes, Microsoft, and the Red Cross have devoted considerable resources to the institution of APL-language preservation programs for varying reasons. It is thought that APL will become useful very soon:
“We at Microsoft believe that APL is truly the next big language for the .NET framework and rapid application development. I mean, pirates! What could be any more RAD than that? We think that APL will be used to write all of the hottest software, and have already started training the Windows team to use it. By integrating pirates into the next version of Windows, we can totally get rid of memory leaks, since the pirates will bail the operating system until it reaches shore. We will need a way to talk to these pirates, and let them know we've got a bounty on them if they don't comply. This way is APL.”
At the time of this press release, Ballmer was found throwing chairs at decrepit elders. When Steve Jobs was asked for comment, his response was simply, "Apple did it first! They stole APL from us!" to which Ballmer said, "Bah! Go smoke some grass with those damn UNIX hippies... communists, the whole lot of you!" In response to this, the Free Software Foundation announced a distribution of APL that does not violate your rights, as part of a project known as "GNPLBWWTTNIGPLS", or "GNPLBWWTTNIGPL is Not a Pirate's Language But We Were Tempted To Name It GPL."
edit Revival
Though APL has all but become a dead language, it is beginning to enjoy a resurgence of sorts. Those who identify themselves as the descendants of pirates, Pirate Americans, have begun to embrace this language as a natural part of their cultural diversity. It is also pointed out that the Gaelic languages are nowhere near as useful, beautiful, or poetic as APL, yet these languages are actively preserved. This argument is not motivated by jealousy, but rather, the infallible truth. Besides, linguistic experts agree; in your face, Isle of Man!
APL is often used by teenagers to seduce their mates, so that they can wrap them up in cocoons and consume their delicate innards at a more convenient time. In Finland, for instance, it is customary for the male participant to shout an endless stream of expletives at the female participant's father in order to gain his approval. When successful, the two will sing sea shanties by the sea shore and consume copious amounts of alcohol. Meanwhile, the female will spend hours crying because she was stood up, and it's also her time of the month, and everything about life totally sucks.
edit Scholarly Interest
APL has also become notable in that it enables depressed Liberal Arts students to continue to lie to themselves about the usefulness of their degree programs. In the year 5 alone, an estimated 4,500 doctoral degrees were awarded to students who authored dissertations on the subject of APL and its literary works. Half of these went on to be published in esteemed journals such as Periodicals of Utter Bullshit, Creation Science, and The Daily Penny. That year, many scientists, mathematicians, and engineers hung their heads in disbelief.
Most scholarly works involving APL are associated with its vast poetry collection. Pirates have been known to be deeply introspective and sensitive individuals, and have left a wealth of literary work in their wake. It is foolishly believed that by understanding poetry and prose written by pirates, that humankind may one day live in peace. Despite the fact that pirates completely eschew technology, it is a well known fact within the literature that pirates have encoded, amongst other things, the cure for cancer, the solution to world hunger, and the answer to life, the universe, and everything within their writings. This is not known because anybody has actually been able to successfully comprehend the language in its entirety; rather it is claimed to be so by those seeking grant money, fame, or cultural acceptance.
More recently, it has been useful for literary scholars to win pissing contests with laymen by developing untenable explanations for otherwise clear text. APL has the advantage of allowing these scholars to effectively annihilate any opposition, since only a native speaker of APL is really qualified to say anything about the subject. Since so few native speakers of APL exist, this allows English professors an upper hand, for instance, when claiming that a poem written by an opium addict was, in fact, not meant to express insobriety, but deep artistic reflection.
edit Venues of Learning
Despite the fact that APL is so infrequently spoken, there are many ways one may obtain APL literacy. The preferred method has always been to visit a bar on the coastline. Using this method, the customary and polite way to find a tutor is to find the nearest pirate, spit on him, knock his mug out of his hand, and insult his mother. If the successful, a brawl will occur, and somebody will likely lose a limb. This means that the pirate has accepted your query, and now considers you part of his circle of friends. Training will usually begin at the break of dawn, and mostly stresses fraternity antics.
Because of the somewhat violent nature of the former method, new methods have been introduced by pansies who can't hold their own in a fist-fight. One may purchase ridiculously expensive and ineffective software, such as Rosetta Stone, and study the language oneself. The self study method has been shown to work fairly well, as long as one does not intend to communicate with native speakers of APL.
A final method is to ask the Pope for instruction. His Imminence eschews concepts such as privacy and sleep so that he can pretend to listen to all of your trivial problems. Each year, millions of devotees take pilgrimages to the Vatican so that they can have the instrument of God instill their particular language of choice into their thought processes. This method, perhaps, has the greatest success rate, but because of the sheer volume of people who harass enthusiastically question his Grace, the Vatican has started outsourcing this responsibility to India. As a result, this method is likely to be extremely expensive, and leads mostly to tears.

